The “Stone Boulders” – All 12-Group (4,096) and 16-Group (65,536) L/R Sticking Combinations In PDF Format

George L. Stone's Stick Control

You should have a copy regardless (amazon.com direct link).

[Drafted as an article for somewhere, stuck here instead…]

You could spend your life on the first six pages of “Stick Control” and still not cover all the possibilities. Dynamics, accents, foot-hand, foot-foot, fast/slow, hands on top of foot patterns, feet on top of hand patterns, regroupings and accenting in 5-7-4 (regrouping of the 16 strokes per pattern), 7-5-4 (re-regrouping of the 16 strokes), yadda yadda. If you see the first six pages of Stick Control as just exercises, you miss the fantastic complexity YOU can introduce to constantly humble yourself while hovering over a practice pad.

As I look at the sets of exercises, I see what I assume most of us do – paradiddles, singles, doubles, multiple-hits of the same stick, some oddball patterns you start playing as written and then mess up without knowing, etc. The question I found myself asking was “What drove Stone to use this particular sequence?” I eventually turned that question around and decided to answer the question “What did Stone leave out?” The PDFs linked to this article are what I’ve affectionately come to call the “Stone Boulder,” providing EVERY sticking combination Stone included and every other combination he didn’t. Some intro to how and why is below, followed by a bit of explanation. I think the patterns themselves are self-explanatory.

While not the most cite-able examples in all of genomics, there have always been passing references to drumming “being in someone’s DNA.” As it happens, drumming and biology did overlap in general approach during the mid-80’s-to-early-90’s (or so) in the great heyday of linear drumming (go dig out your Murray Houllif and Gary Chaffee books). The idea is simple: no two drums/cymbals hit at the same time, producing an often staccato and generally (well, to my ears anyway) more melodic sound from the drums (and much easier to transcribe than some of the superhuman overlapping rhythms people are having fun playing today). Ignoring the complexities of 3.5 billions years of evolution, DNA works the same way as these linear patterns to convey a message. The four bases in your DNA, A (adenine), C (cytosine), G (guanine), and T (thymine), act as a code that is read like those old drum beats were played – one at a time with no doubling-up please. The identical three million base-long DNA sequences in each of your cells (see CSI) could be turned from seemingly random patterns of [A,C,G,T] into seemingly random patterns of [L,R,B,H] (that’s left hand, right hand, bass drum foot, hi-hat foot), then some experimental linear drumming composer could “play” your genome. Better still, if the transcriber was as good as your cellular machinery, the entire performance could be written down and reconverted into [A,C,G,T] format exactly so you could be cloned and double-drum with someone who rushes and slows down just as much as you do.

While most people think of a drum programmer as someone who generates patterns on a computer, I took the route of programming to generate patterns to drum. I most certainly did NOT put the pattern pages together by hand (I promise, no mistakes). A small script in the Perl programming language used to generate DNA sequences did all of the dirty work (including making sure all patterns only appear ONCE in each document). The math for figuring out the total number of left/right patterns is quite simple. The number of combinations of unique sticking patterns for a particular pattern length is 2^n, n being the number of beats. For a single beat, that’s 2^1, or just 2, that single hit being performed with either the left or right hand. For a four-stroke pattern, that’s 2^4 (2 * 2 * 2 * 2), or 16 total patterns. These are shown below out of academic interest (although I hope you could write them down from memory).

Now, consider the first six pattern pages of the Stone book. 16 beats per pattern. That’s 2^16, or 65536 total patterns. At 20 patterns per page, the complete Stone book of these first six pages would take up 3,277 pages. At 2 seconds per pattern, you could rip through all 3,277 pages in about 36 hours 30 minutes (about the perceived length of a society gig).

For you fellow jazzers out there looking for a more swingin’ set, I’ve also included the same sticking deal with a triplet-feel set (12 beats instead of 16, so you’ve only got 4096 patterns to contend with, meaning you could play through the whole set in about 2 hours 30 minutes).

4,096 patterns are bad enough. 65,536 is borderline something uncouth. On the one hand, that’s a lot of patterns either way. On the other, for the obsessive compulsive readers, these are IT. There are no other 12- or 16-stroke sticking combinations that have a stick hitting on each beat (that is, no rests). As Terry Bozzio has said in one form or another in his many clinics introducing his ostinato independence exercises “once you’ve played through the 16, you’ve played every 16th note pattern there is.”

And it could be worse! If you wanted every combination of left, right and rest, that’s 3^16, or 43,046,721 patterns. At 2 seconds per pattern, that’s 23,915 hours, or about 2 years and 8 months. I pondered doing the same thing for all 16-note linear drum patterns (L,R,B,F), which would produce 4^16, or 4,294,967,296 patterns. That’s 2,386,093 hours, or 272 years and 3 months (that’s approaching four reincarnations of “no life”).

Each full page has three columns of 40 patterns (120 per page), producing a document that’s only 547 pages long (but entirely green-friendly in PDF format). You will note that most of the pages look like the same stupid thing. This is because the mechanism of generation for the sequences involved making single changes at a single position and walking down the entire 16-stroke sets until all changes had been accounted for. I become bored to tears staying on a single page and generally scroll at random and point the stick at the screen to pick a pattern to play. Be as methodical or all-over-the-map as you will.

Is there a good reason for doing this? Not particularly. There are lots of patterns here that are a mechanical challenge for your arms, but many (many, many) of these patterns do not immediately lend themselves to the funk-ability of some of the Stone patterns (which tend to at least have groupings that, again, reflect rudiments or make you work one limb preferentially in a “usable” way). They are here mostly for completeness and, for when you want to confuse your limbs, picking a page or more at random and seeing how the patterns feel. As independence exercises teach us very early on, our brains are wired for preferential patterning (you hit the same foot as you would hand, you’re non-dominant hand sucks, your hi-hat foot is born useless, and other revelations). This document is simply another PDF you can lose on your machine somewhere or have in that hidden work folder that comes out and gets an intense few looks as you try to split your left and right hands apart more.

And, it should be obvious, the same applies for your feet.

Having fought through enough of the combinations, I began to notice something I’m sure all of us have encountered as we approach that hypnotic state of cruising through a pattern we “get.” Some patterns feel really good to play, but only after you’ve internalized them enough to “play something else,” like feeling an odd clave or taking the patterns with many doubles of one hand and ripping them into a bounce-driven frenzy (or, invariably, playing one pattern we love to play to find out it’s a pattern you heard and memorized in a more musical context on record). The one benefit I’ve found from having this PDF around is that I have all of the patterns in one place, which makes me think harder about the different ways to play the patterns (although that is only a fringe benefit). If you treat them like a journey and not just the first 5 minutes of your warm-up routine, I suspect you could spend your life on any one page and still not cover all of the bases.

So, without further ado:

2011july13_stone_boulder_sticking_series_V1.pdf
2011july13_stone_boulder_jazz_grouping_series_V1.pdf

UNAFold 3.8, MFold Utilities 4.5/4.6 And Additional Component Installation (Using XCode Tools 3 And Fink 0.29.21) For OSX 10.6.x

NOTE: The version numbers for everything are given specifically because aspects of the installation process may change with different versions and, in the event, I will not necessarily know the answer to subsequent problems if major version changes include major changes to the below (and that should clear up the “qualifications” section).

The UNAFold (UNified Nucleic Acid Fold(ing)) nucleic acid folding and hybridization prediction program set (here using version 3.8) can by itself be built with few (and not important) errors in OSX with Xcode Tools 3. The actual running of UNAFold.pl produces several errors that do not affect the run but do affect the amount/format of the output. It is my assumption that any OS running a less-than “kitchen sink” installation of Linux/Unix (Ubuntu, gentoo and Damn Small Linux come to mind) will have these errors and will require subsequent installations of programs/libraries that pieces of UNAFold rely on for processing output into, specifically, images and PDF files. OSX has the same issue that is easy to handle using Fink (and less so trying to install otherwise completely unrelated programs to make these “dependencies” (programs and libraries) available to UNAFold). Once Fink is installed, it is a few-step process to build UNAFold, move the Mfold Utilities contents to their proper folders (and there is a small trick here as well), and generate a UNAFold-complete install for all your DNA/RNA needs.

1. UNAFold 3.8 Installation

To begin, download (currently at mfold.rna.albany.edu/?q=DINAMelt/software), extract, open a terminal, cd into the unafold_3.8 directory (likely ~/Downloads/unafold_3.8), and run ./configure.

[prompt]$ cd ~/Downloads/unafold_3.8
[prompt]$ ./configure

On my machine (MacBook Pro, 10.6.x OSX + XCode Tools 3), this produces the output found in the local file 2011june_unafold_configure_output.txt.

You will likely note two sets of errors in the ./configure output:

./configure: line 8579: sort: No such file or directory
./configure: line 8576: sed: No such file or directory
./configure: line 10077: sort: No such file or directory
./configure: line 10074: sed: No such file or directory

The 10077 and 10074 errors are a bit odd because there are only 10039 lines in the configure file.

Are these errors important? No, you can build UNAFold just fine. I have run into these two “sort” and “sed” problems with a few other build attempts in OSX but have no good answer as to how to get around them (in case you’re wondering, sort and sed are most certainly installed on the machine. The “sort” error can be removed by specifying the path explicitly in the configure file (in line 8579, change “sort” the “/usr/bin/sort”), but the sed error persists in the few attempts I tried to work around it. It doesn’t appear to be a simple PATH issue. I’m not yet interested enough in finding a proper solution but, if you know, please post a comment or send a message. Is it just a character issue as discussed at itmercenary.livejournal.com/1585.html?).

running “make” produces the output found in the local file 2011june_unafold_make_output.txt.

[prompt]$ make

No issues. To install UNAFold, which will default to putting components into /usr/local/bin and /usr/local/share/, run sudo make install, which produces the output found in the local file 2011june_unafold_sudo_make_install_output.txt.

[prompt]$ sudo make install

Again, no issues. You will now have a populated /usr/local/bin folder.

2. MFold Utilities 4.5 (and, currently, the source for 4.6)

The next (optional) step is the inclusion of the mfold_util-4.5-Mac binaries (currently available at mfold.rna.albany.edu/?q=mfold/download-mfold), which I’ve also placed into the /usr/local/bin folder by extracting the contents of this file, them performing a cp * /usr/local/bin from within the MacBin directory.

[prompt]$ cd ~/Downloads/MacBin/
[prompt]$ sudo cp * /usr/local/bin

The processing of the data into plots with these programs requires that a set of *.col files be placed in the folder /usr/local/shared/mfold_util. Furthermore, these *.col are NOT provided in the mfold_util-4.5-Mac binary package. To get these files, you need only download the mfold_util-4.6.tar.gz file (currently at mfold.rna.albany.edu/?q=mfold/download-mfold), cd your way into src, make the /usr/local/shared/mfold_util folder, and copy the *.col files to /usr/local/shared/mfold_util.

[prompt]$ sudo mkdir /usr/local/shared/mfold_util
[prompt]$ cd Downloads/mfold_util-4.6/src
[prompt]$ sudo cp *.col /usr/local/shared/mfold_util

3. Fink 0.29.21 Install From Scratch

The first indication that other work was required came from trying to run mutplot randomly, which produced the following error:

dyld: Library not loaded: /sw/lib/libpng12.0.dylib
  Referenced from: /usr/local/bin/mutplot
  Reason: image not found
Trace/BPT trap

As digging around for libraries is not as straightforward as it would be for a Linux distro, I chose instead to solve the many problems by installing dependencies through the Fink program (currently fink-0.29.21). As 10.6.x users will find that there is no available Fink binary, you must build this from the source (which, with Xcode Tools 3 installed, occurs without error. If you don’t have Xcode Tools 3 installed, the new mechanism for buying a copy of XCode Tools 4 is less than ideal (to me, anyway. $4.99?) but now occurs through the App Store).

Download the fink source (fink 0.29.21), extract, cd into the fink-0.29.21 directory, and run bootstrap. Upon completion, you run pathsetup.sh, source your .profile, and update fink.

[prompt]$ cd ~/Downloads/fink-0.29.21
[prompt]$ ./bootstrap
[prompt]$ . /sw/bin/pathsetup.sh 
[prompt]$ cd ~/
[prompt]$ source .profile
[prompt]$ fink selfupdate-rsync
[prompt]$ fink update-all

The output for my installation can be found in 2011june_fink_install_output.txt. The rsync output can be found in 2011june_fink_selfupdate_rsync_output.txt. NOTE: You will be asked several questions about the installation process. Be prepared to blindly select the default settings with [enter], but don’t just walk away from the screen.

This completes the UNAFold install, MacBin install, and Fink install, meaning now we can walk through the dependencies.

4. Installing UNAFold (well, MFold Utils) Dependencies

First dependency-free UNAFold.pl run attempt produces the following error:

[prompt]$ UNAFold.pl seqtest.txt 
Checking for boxplot_ng... dyld: Library not loaded: /sw/lib/libpng12.0.dylib
  Referenced from: /usr/local/bin/boxplot_ng
  Reason: image not found
found, supports Postscript
Checking for hybrid-plot-ng... found, supports Postscript
Checking for sir_graph_ng or sir_graph... dyld: Library not loaded: /sw/lib/libpng12.0.dylib
  Referenced from: /usr/local/bin/sir_graph
  Reason: image not found
found, supports Postscript
Checking for ps2pdfwr... not found
Calculating for seqtest.txt, t = 37

As the UNAFold install page states, you need glut, the GD library, and gnuplot installed (and all of the many libraries therein).

[prompt]$ fink install libjpeg tetex gd2 gnuplot

For gnuplot, you will be required to make a few selections during the build process (blindly hitting the enter key at these questions will do, but this is not just a “type and go” install process. And it took about two hours on a MBP).

A final working error-free run looks as below, leaving you to process the data with the MFold Utilities as you like:

[prompt]$ UNAFold.pl seqtest.txt 
Checking for boxplot_ng... found, supports Postscript
Checking for hybrid-plot-ng... found, supports Postscript
Checking for sir_graph_ng or sir_graph... found, supports Postscript
Checking for ps2pdfwr... found
Calculating for seqtest.txt, t = 37

Maq-0.6.x Or Maq-0.7.x (And Likely Others) Installation In Ubuntu 10.04 LTS (And Likely Others)

So, with the BclConverter installation complete and a small QSEQ-to-FASTQ script available to convert the QSEQ output, the/a next step is the alignment of your lane-worth of sequenced DNA. The Maq program is used by the Cornell Sequencing Center (and was recommended as the workhorse tool for this task) and is available by link from the Illumina third-party tools list. In keeping with my no-interest-in-installing-another-distro run of Ubuntu luck, the procedure below explains the process of building Maq using as much apt-get as possible. In the case of Maq, there is one small busy step in the installation process because we need a copy of libstdc++.so.5 local that is NOT available by some easy package install (although what one has to do isn’t terribly difficult either and I’ve linked local copies of the two .deb files below).

Installation Procedure

The process begins with apt-get, continues to dpkg, and then is finished with an easy make.

1. apt-get Install List

The official package list, I am quite sure, is below. From a Terminal window:

sudo apt-get install zlib1g-dev libssl-dev build-essential gcc g++ rpm ia32-libs

I say this because I (1) have installed several other packages on the machines I’ve been working on prior to the Maq builds and (2) I’ve no interest in wiping machines to perfect a super-clean install. If there is an error in the Maq-make, it is possible an additional package is missing (although I suspect this will not be the case, as there is little needed for the Maq build). If there is an error, the solution may simply be to blindly add the following additional packages (and, if you installed the BclConverter, you have this all installed anyway).

YOU LIKELY DON’T NEED THE FOLLOWING, BUT JUST IN CASE:

sudo apt-get install build-essential mercurial cmake python2.6-dev python3.1-dev gettext
libopenal1 libopenexr-dev libavdevice52 freeglut3-dev libglew1.5-dev libxmu-dev libxi-dev
libfreeimage-dev doxygen libqt4-dev bison flex libbz2-dev libpng12-dev libxml-simple-perl
ia32-libs lib32asound2 lib32ncurses5 lib32nss-mdns lib32z1 lib32gfortran3 gcc-4.3-multilib
gcc-multilib lib32gomp1 libc6-dev-i386 lib32mudflap0 lib32gcc1 lib32gcc1-dbg lib32stdc++6
lib32stdc++6-4.3-dbg libc6-i386 csh g++ g++-4.3 libstdc++6-4.3-dev g++-multilib
g++-4.3-multilib gcc-4.3-doc libstdc++6-4.3-dbg libstdc++6-4.3-doc nfs-common
nfs-kernel-server portmap ssh gnuplot

2. Adding 32-bit (Needed For Both) And 64-bit (If Running 64-bit) libstdc++.so.5

The following process assumes you know where the two .deb files are sitting and that you have access to this folder (I assume you’ve downloaded to Downloads or Desktop, drive your Terminal window in that direction with cd ~/Downloads or cd ~/Desktop). The two .deb files in question that contain (I believe) the most recent versions of libstdc++.so.5 are linked below (and sitting on my website – you’ll have to unzip them with a double-click or a gunzip *.zip in the download’ed directory):


libstdc++5_3.3.6-18_i386.deb (as libstdc5_3.3.6_18_i386.deb.zip)
libstdc++5_3.3.6-18_amd64.deb (as libstdc5_3.3.6_18_amd64.deb.zip)

These are an “additional runtime library for C++ programs built with the GNU compiler.” The i386 is the 32-bit version. You definitely need this one. The amd64 is needed if you installed the 64-bit Ubuntu distro. You’ll STILL need to install the i386 version.

A. For the 32-bit version, the installation is simple:

sudo dpkg -i libstdc++5_3.3.6-18_i386.deb

B. For the 64-bit version, the installation is also simple:

sudo dpkg -i libstdc++5_3.3.6-18_amd64.deb

Output as below:

Selecting previously deselected package libstdc++5.
(Reading database ... 169294 files and directories currently installed.)
Unpacking libstdc++5 (from libstdc++5_3.3.6-18_amd64.deb) ...
Setting up libstdc++5 (1:3.3.6-18) ...

Processing triggers for libc-bin ...
ldconfig deferred processing now taking place

The second step is only mildly more involved. These five steps (1) extract out the contents of libstdc++5_3.3.6-18_i386.deb without installing the library (so no over-writing), (2) enter the usr/lib directory you just extracted, (3) copy libstdc++.so.5.0.7 to /usr/lib32, (4) cd into /usrlib32, and (5) make a symbolic link for libstdc++.so.5.

dpkg --extract libstdc++5_3.3.6-18_i386.deb ./
cd usr/lib
sudo cp libstdc++.so.5.0.7 /usr/lib32
cd /usr/lib32/
sudo ln -s libstdc++.so.5.0.7 libstdc++.so.5
cd ~/

And that is all.

3. Installing Maq

sudo mv maq-0.7.1.tar.bz2 /opt/
cd /opt
sudo tar xvjf maq-0.7.1.tar.bz2 

Produces…

tar: Record size = 8 blocks
maq-0.7.1/
maq-0.7.1/AUTHORS
maq-0.7.1/COPYING
maq-0.7.1/ChangeLog
maq-0.7.1/FUTURES
maq-0.7.1/INSTALL
maq-0.7.1/Makefile.am
maq-0.7.1/Makefile.generic
maq-0.7.1/Makefile.in
maq-0.7.1/NEWS
maq-0.7.1/PROBLEMS
maq-0.7.1/README
maq-0.7.1/aclocal.m4
maq-0.7.1/algo.hh
maq-0.7.1/altchr.cc
maq-0.7.1/assemble.cc
maq-0.7.1/assemble.h
maq-0.7.1/assopt.c
maq-0.7.1/autogen.sh
maq-0.7.1/aux_utils.c
maq-0.7.1/bfa.c
maq-0.7.1/bfa.h
maq-0.7.1/break_pair.c
maq-0.7.1/cleanup.sh
maq-0.7.1/config.guess
maq-0.7.1/config.h.in
maq-0.7.1/config.sub
maq-0.7.1/configure
maq-0.7.1/configure.ac
maq-0.7.1/const.c
maq-0.7.1/const.h
maq-0.7.1/csmap2ntmap.cc
maq-0.7.1/dword.hh
maq-0.7.1/eland2maq.cc
maq-0.7.1/fasta2bfa.c
maq-0.7.1/fastq2bfq.c
maq-0.7.1/genran.c
maq-0.7.1/genran.h
maq-0.7.1/get_pos.c
maq-0.7.1/glf.h
maq-0.7.1/glfgen.cc
maq-0.7.1/indel_call.cc
maq-0.7.1/indel_pe.cc
maq-0.7.1/indel_soa.cc
maq-0.7.1/install-sh
maq-0.7.1/main.c
maq-0.7.1/main.h
maq-0.7.1/mapcheck.cc
maq-0.7.1/maq.1
maq-0.7.1/maq.pdf
maq-0.7.1/maq.pod
maq-0.7.1/maqmap.c
maq-0.7.1/maqmap.h
maq-0.7.1/maqmap_conv.c
maq-0.7.1/match.cc
maq-0.7.1/match.hh
maq-0.7.1/match_aux.cc
maq-0.7.1/merge.cc
maq-0.7.1/missing
maq-0.7.1/pair_stat.cc
maq-0.7.1/pileup.cc
maq-0.7.1/rbcc.cc
maq-0.7.1/read.cc
maq-0.7.1/read.h
maq-0.7.1/rmdup.cc
maq-0.7.1/scripts/
maq-0.7.1/scripts/asub
maq-0.7.1/scripts/farm-run.pl
maq-0.7.1/scripts/fq_all2std.pl
maq-0.7.1/scripts/maq.pl
maq-0.7.1/scripts/maq_eval.pl
maq-0.7.1/scripts/maq_plot.pl
maq-0.7.1/scripts/maq_post.pl
maq-0.7.1/scripts/maq_sanger.pl
maq-0.7.1/scripts/paf_utils.pl
maq-0.7.1/scripts/solid2fastq.pl
maq-0.7.1/seq.c
maq-0.7.1/seq.h
maq-0.7.1/simulate.c
maq-0.7.1/sort_mapping.cc
maq-0.7.1/stdaln.c
maq-0.7.1/stdaln.h
maq-0.7.1/stdhash.hh
maq-0.7.1/submap.c
maq-0.7.1/subsnp.cc
cd maq-0.7.1/

README Contents

Mapass2 is a software that builds mapping assemblies from short reads
generated by the next-generation sequencing machines. It is particularly
designed for Illumina-Solexa 1G Genetic Analyzer, which typically
generates reads 25-35bp in length.

Mapass2 first aligns reads to reference sequences and then calls the
consensus. At the mapping stage, maq performs ungapped alignment. For
single-end reads, maq is able to find all hits with up to 2 or 3
mismatches, depending on a command-line option; for paired-end reads, it
always finds all paired hits with one of the two reads containing up to
1 mismatch. At the assembling stage, maq calls the consensus based on a
statistical model. It calls the base which maximizes the posterior
probability and calculates a phred quality at each position along the
consensus. Heterozygotes are also called in this process.

For more information, see also maq website:

http://mapass.sourceforge.net

INSTALL Contents

There are two ways to compile maq. The first way is to use the GNU
building systems. Simply type ‘./configure; make; make install’ to
compile and to install maq. Three executables ‘maq’, ‘maq.pl’ and
‘farm-run.pl’ will be copied to ‘/usr/local/bin’ by default.

Alternatively, one could compile with ‘make -f Makefile.generic’ and
manually copy the three executables to the destination directory.
Modification to ‘Makefile.generic’ is sometimes needed for different
architectures.

As I’m running this from /opt, we’ll be doing the first way to compile Maq but using “sudo” in each case.

USERID@MACHINE:/opt/maq-0.7.1$ sudo ./configure 

Produces…

checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for a thread-safe mkdir -p... /bin/mkdir -p
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking build system type... x86_64-unknown-linux-gnu
checking host system type... x86_64-unknown-linux-gnu
checking for gcc... gcc
checking for C compiler default output file name... a.out
checking whether the C compiler works... yes
checking whether we are cross compiling... no
checking for suffix of executables... 
checking for suffix of object files... o
checking whether we are using the GNU C compiler... yes
checking whether gcc accepts -g... yes
checking for gcc option to accept ISO C89... none needed
checking for g++... g++
checking whether we are using the GNU C++ compiler... yes
checking whether g++ accepts -g... yes
checking if gcc accepts -m64... yes
checking how to run the C preprocessor... gcc -E
checking for grep that handles long lines and -e... /bin/grep
checking for egrep... /bin/grep -E
checking for ANSI C header files... yes
checking for sys/types.h... yes
checking for sys/stat.h... yes
checking for stdlib.h... yes
checking for string.h... yes
checking for memory.h... yes
checking for strings.h... yes
checking for inttypes.h... yes
checking for stdint.h... yes
checking for unistd.h... yes
checking zlib.h usability... yes
checking zlib.h presence... yes
checking for zlib.h... yes
configure: creating ./config.status
config.status: creating Makefile
config.status: creating config.h
USERID@MACHINE:/opt/maq-0.7.1$ sudo make

Produces…

cd . && /bin/bash /opt/maq-0.7.1/missing --run autoheader
/opt/maq-0.7.1/missing: line 54: autoheader: command not found
WARNING: `autoheader' is missing on your system.  You should only need it if
         you modified `acconfig.h' or `configure.ac'.  You might want
         to install the `Autoconf' and `GNU m4' packages.  Grab them
         from any GNU archive site.
rm -f stamp-h1
touch config.h.in
cd . && /bin/bash ./config.status config.h
config.status: creating config.h
config.status: config.h is unchanged
make  all-am
make[1]: Entering directory `/opt/maq-0.7.1'
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c main.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c const.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c seq.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c bfa.c
bfa.c: In function ‘nst_load_bfa1':
bfa.c:31: warning: ignoring return value of ‘fread', declared with attribute warn_unused_result
bfa.c:32: warning: ignoring return value of ‘fread', declared with attribute warn_unused_result
bfa.c:33: warning: ignoring return value of ‘fread', declared with attribute warn_unused_result
bfa.c:35: warning: ignoring return value of ‘fread', declared with attribute warn_unused_result
bfa.c:37: warning: ignoring return value of ‘fread', declared with attribute warn_unused_result
bfa.c: In function ‘nst_bfa_len':
bfa.c:46: warning: ignoring return value of ‘fread', declared with attribute warn_unused_result
bfa.c:48: warning: ignoring return value of ‘fread', declared with attribute warn_unused_result
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o read.o read.cc
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c fasta2bfa.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c fastq2bfq.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o merge.o merge.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o match_aux.o
 match_aux.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o match.o match.cc
match.cc: In function ‘int alt_cal_mm(bit64_t)':
match.cc:58: warning: suggest parentheses around ‘+' in operand of ‘&'
match.cc:61: warning: suggest parentheses around ‘+' in operand of ‘&'
match.cc: In function ‘int alt_cal_err(bit64_t, bit64_t)':
match.cc:67: warning: suggest parentheses around ‘+' in operand of ‘&'
match.cc:70: warning: suggest parentheses around ‘+' in operand of ‘&'
match.cc: In function ‘int ma_match(int, char**)':
match.cc:525: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)', declared 
with attribute 
warn_unused_result
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o sort_mapping.o 
sort_mapping.cc
sort_mapping.cc: In function ‘int ma_make_pair(const match_aux_t*, const match_info_t*, const 
match_info_t*, 
pair_info_t*)':
sort_mapping.cc:59: warning: suggest parentheses around arithmetic in operand of ‘^'
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o assemble.o 
assemble.cc
assemble.cc: In function ‘base_call_aux_t* assemble_cns_collect(assemble_pos_t*, const 
assemble_aux_t*)':
assemble.cc:106: warning: suggest parentheses around arithmetic in operand of ‘|'
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o 
pileup.o pileup.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o 
mapcheck.o mapcheck.cc
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c get_pos.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c assopt.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c aux_utils.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o rbcc.o rbcc.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o subsnp.o 
subsnp.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o pair_stat.o 
pair_stat.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o indel_soa.o 
indel_soa.cc
indel_soa.cc: In function ‘void fill_counter(bit32_t*, int, nst_bfa1_t*, void*)':
indel_soa.cc:42: warning: suggest parentheses around ‘-' inside ‘< <'
indel_soa.cc:56: warning: suggest parentheses around ‘-' inside ‘<<'
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c maqmap.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c maqmap_conv.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o altchr.o 
altchr.cc
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c submap.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o rmdup.o 
rmdup.cc
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c simulate.c
In file included from /usr/include/string.h:640,
                 from maqmap.h:23,
                 from simulate.c:11:
In function ‘memset',
    inlined from ‘simustat_core' at simulate.c:386:
/usr/include/bits/string3.h:86: warning: call to __builtin___memset_chk will always overflow 
destination buffer
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c genran.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o indel_pe.o 
indel_pe.cc
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c stdaln.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o indel_call.o 
indel_call.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o 
eland2maq.o eland2maq.cc
eland2maq.cc: In function ‘hash_map_char* read_list(FILE*)':
eland2maq.cc:33: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)', 
declared with attribute warn_unused_result
eland2maq.cc: In function ‘void eland2maq_core(FILE*, FILE*, void*)':
eland2maq.cc:88: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)', 
declared with attribute warn_unused_result
eland2maq.cc:96: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)', 
declared with attribute warn_unused_result
eland2maq.cc:99: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)', 
declared with attribute warn_unused_result
eland2maq.cc: In function ‘void novo2maq_core(FILE*, FILE*, void*)':
eland2maq.cc:323: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)', declared 
with attribute warn_unused_result
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o 
csmap2ntmap.o csmap2ntmap.cc
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c break_pair.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o 
glfgen.o glfgen.cc
glfgen.cc: In function ‘glf1_t* glfgen1_core(assemble_pos_t*, const assemble_aux_t*, bit8_t)':
glfgen.cc:43: warning: suggest parentheses around arithmetic in operand of ‘|'
g++  -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2   -o maq main.o const.o seq.o bfa.o read.o 
fasta2bfa.o fastq2bfq.o merge.o match_aux.o match.o sort_mapping.o assemble.o pileup.o 
mapcheck.o 
get_pos.o assopt.o aux_utils.o rbcc.o subsnp.o pair_stat.o indel_soa.o maqmap.o maqmap_conv.o 
altchr.o submap.o rmdup.o simulate.o genran.o indel_pe.o stdaln.o indel_call.o eland2maq.o 
csmap2ntmap.o break_pair.o glfgen.o -lm -lz 
make[1]: Leaving directory `/opt/maq-0.7.1'
USERID@MACHINE:/opt/maq-0.7.1$ sudo make install

Produces…

make[1]: Entering directory `/opt/maq-0.7.1'
test -z "/usr/local/bin" || /bin/mkdir -p "/usr/local/bin"
  /usr/bin/install -c 'maq' '/usr/local/bin/maq'
test -z "/usr/local/bin" || /bin/mkdir -p "/usr/local/bin"
 /usr/bin/install -c 'scripts/maq.pl' '/usr/local/bin/maq.pl'
 /usr/bin/install -c 'scripts/farm-run.pl' '/usr/local/bin/farm-run.pl'
 /usr/bin/install -c 'scripts/maq_plot.pl' '/usr/local/bin/maq_plot.pl'
 /usr/bin/install -c 'scripts/maq_eval.pl' '/usr/local/bin/maq_eval.pl'
make[1]: Nothing to be done for `install-data-am'.
make[1]: Leaving directory `/opt/maq-0.7.1'

The Maq package is installed in /usr/local/bin and should be available immediately without any path calls. In the interest of running a brief test, I’ve provided a fastq file for phi-X174 and the “easy” command line run to run an alignment (rendered movie from the virusworld website, including a second half featuring the lovely QuteMol program, is below). While I wouldn’t object to hosting a full lane of phi-X174, the 1.9 GB of fragments = unbearably long server upload. Suffice it to say, if you have a phi-X174 lane and you’ve run the BCL-to-QSEQ-to-FASTQ procedure in the BclConverter post, you have a properly formatted PhiXSequence.fastq for running this example.

You can download the phi-X174 sequence at phi_X174_sequence.fastq.gz, a local version of the file you can find at the National Center for Biotechnology Information. The sequence is below because, well, I wanted to have a sequence present on the blog post (and it is absolutely fascinating to me that this is the instruction manual for something).

>gi|216019|gb|J02482.1|PX1CG Coliphage phi-X174, complete genome
GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCGGAAGGAG
TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCATGATGTTATTTCTTCATTTGGAGGTAAAAC
CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
CGGGCAATAACGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTGCTATTCAGCGTTTGATGAATGCAATGCGACAG
GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
CGTCTTCATTTCCATGCGGTGCACTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA

With this file downloaded and your phi-X174 fragment collection sitting in a file [I will assume is named] phi_X174_seq_fragments.fastq in the same directory, the command line run is simple:

maq.pl easyrun -d phi_X174 phi_X174_seq.fastq phi_X174_seq_fragments.fastq >& phi_X174.log
drwxr-xr-x 2 user user       4096 2010-12-11 17:18 phi_X174
-rw-r--r-- 1 user user       3524 2010-12-11 17:18 phi_X174.log
-rw-r--r-- 1 user user       5529 2010-12-11 16:39 phi_X174_seq.fastq
-rw-r--r-- 1 user user 1921502305 2010-12-11 16:40 phi_X174_seq_fragments.fastq

This will produce the phi_X174.log results file (check for errors. Log contents below)…

-- CMD: /usr/local/bin/maq fasta2bfa /home/user/phi_X174_seq.fastq \ 
phi_X174/ref.bfa 2> /dev/null
-- CMD: /usr/local/bin/maq fastq2bfq -n 2000000 /home/user/phi_X174_seq_fragments.fastq \
phi_X174/read1
-- finish writing file 'phi_X174/read1@1.bfq'
-- finish writing file 'phi_X174/read1@2000001.bfq'
-- finish writing file 'phi_X174/read1@4000001.bfq'
-- finish writing file 'phi_X174/read1@6000001.bfq'
-- finish writing file 'phi_X174/read1@8000001.bfq'
-- finish writing file 'phi_X174/read1@10000001.bfq'
-- finish writing file 'phi_X174/read1@12000001.bfq'
-- finish writing file 'phi_X174/read1@14000001.bfq'
-- finish writing file 'phi_X174/read1@16000001.bfq'
-- 16259703 sequences were loaded.
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@8000001.txt \
aln1@8000001.map ref.bfa read1@8000001.bfq 2> aln1@8000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@2000001.txt \
aln1@2000001.map ref.bfa read1@2000001.bfq 2> aln1@2000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@6000001.txt \
aln1@6000001.map ref.bfa read1@6000001.bfq 2> aln1@6000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@10000001.txt \
aln1@10000001.map ref.bfa read1@10000001.bfq 2> aln1@10000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@16000001.txt \
aln1@16000001.map ref.bfa read1@16000001.bfq 2> aln1@16000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@4000001.txt \
aln1@4000001.map ref.bfa read1@4000001.bfq 2> aln1@4000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@14000001.txt \
aln1@14000001.map ref.bfa read1@14000001.bfq 2> aln1@14000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@1.txt aln1@1.map \
ref.bfa read1@1.bfq 2> aln1@1.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@12000001.txt \
aln1@12000001.map ref.bfa read1@12000001.bfq 2> aln1@12000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq mapmerge all.map aln1@8000001.map \
aln1@2000001.map aln1@6000001.map aln1@10000001.map aln1@16000001.map \
aln1@4000001.map aln1@14000001.m
ap aln1@1.map aln1@12000001.map)
-- CMD: (cd phi_X174; /usr/local/bin/maq mapcheck ref.bfa all.map > mapcheck.txt)
[ma_mapcheck] processing gi|216019|gb|J02482.1|PX1CG...
-- CMD: (cd phi_X174; /usr/local/bin/maq assemble -N 2 -Q 60 consensus.cns ref.bfa \
all.map 2> assemble.log)
-- CMD: /usr/local/bin/maq cns2fq phi_X174/consensus.cns > phi_X174/cns.fq
-- CMD: /usr/local/bin/maq cns2snp phi_X174/consensus.cns > phi_X174/cns.snp
-- CMD: /usr/local/bin/maq cns2win phi_X174/consensus.cns > phi_X174/cns.win
-- CMD: /usr/local/bin/maq indelsoa phi_X174/ref.bfa phi_X174/all.map > phi_X174/cns.indelse
-- CMD: (cd phi_X174; touch unmap.indel)
-- CMD: /usr/local/bin/maq.pl SNPfilter -q 40 -w 5 -N 2 -f phi_X174/cns.indelse -d 3 \
-D 256 -n 20 phi_X174/cns.snp > phi_X174/cns.final.snp
-- 0 potential soa-indels pass the filter.
-- CMD: (cd phi_X174; ln -s cns.final.snp cns.filter.snp)
-- CMD: /usr/local/bin/maq.pl statmap phi_X174/*.map.log

-- == statmap report ==

-- # single end (SE) reads: 16259703
-- # mapped SE reads: 16011454 (/ 16259703 = 98.47%)
-- # paired end (PE) reads: 0
-- # mapped PE reads: 0 (/ 0 = NA%)
-- # reads that are mapped in pairs: 0 (/ 0 = NA%)
-- # Q>=30 reads that are moved to meet mate-pair requirement: 0 (/ 0 = NA%)
-- # Q<30 reads that are moved to meet mate-pair requirement: 0 (NA%)

…and a “phi_X174” directory (from the “-d”) containing (hopefully) the following file list:

drwxr-xr-x  2 user user      4096 2010-12-11 17:18 .
drwxr-xr-x 19 user user      4096 2010-12-11 17:09 ..
-rw-r--r--  1 user user 337296876 2010-12-11 17:16 all.map
-rw-r--r--  1 user user  41635667 2010-12-11 17:13 aln1@10000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:13 aln1@10000001.map.log
-rw-r--r--  1 user user  42219864 2010-12-11 17:15 aln1@12000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:15 aln1@12000001.map.log
-rw-r--r--  1 user user  42885466 2010-12-11 17:14 aln1@14000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:14 aln1@14000001.map.log
-rw-r--r--  1 user user   5808963 2010-12-11 17:13 aln1@16000001.map
-rw-r--r--  1 user user     18484 2010-12-11 17:13 aln1@16000001.map.log
-rw-r--r--  1 user user  42616782 2010-12-11 17:14 aln1@1.map
-rw-r--r--  1 user user     18493 2010-12-11 17:14 aln1@1.map.log
-rw-r--r--  1 user user  41452684 2010-12-11 17:12 aln1@2000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:12 aln1@2000001.map.log
-rw-r--r--  1 user user  41223383 2010-12-11 17:14 aln1@4000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:14 aln1@4000001.map.log
-rw-r--r--  1 user user  41423788 2010-12-11 17:13 aln1@6000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:13 aln1@6000001.map.log
-rw-r--r--  1 user user  42709777 2010-12-11 17:12 aln1@8000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:12 aln1@8000001.map.log
-rw-r--r--  1 user user      8704 2010-12-11 17:18 assemble.log
lrwxrwxrwx  1 user user        13 2010-12-11 17:18 cns.filter.snp -> cns.final.snp
-rw-r--r--  1 user user       509 2010-12-11 17:18 cns.final.snp
-rw-r--r--  1 user user     10983 2010-12-11 17:18 cns.fq
-rw-r--r--  1 user user         0 2010-12-11 17:18 cns.indelse
-rw-r--r--  1 user user       571 2010-12-11 17:18 cns.snp
-rw-r--r--  1 user user       452 2010-12-11 17:18 cns.win
-rw-r--r--  1 user user      3555 2010-12-11 17:18 consensus.cns
-rw-r--r--  1 user user      4525 2010-12-11 17:17 mapcheck.txt
-rw-r--r--  1 user user  51219471 2010-12-11 17:11 read1@10000001.bfq
-rw-r--r--  1 user user  51533445 2010-12-11 17:11 read1@12000001.bfq
-rw-r--r--  1 user user  52014489 2010-12-11 17:12 read1@14000001.bfq
-rw-r--r--  1 user user   6777154 2010-12-11 17:12 read1@16000001.bfq
-rw-r--r--  1 user user  51764856 2010-12-11 17:09 read1@1.bfq
-rw-r--r--  1 user user  51064770 2010-12-11 17:10 read1@2000001.bfq
-rw-r--r--  1 user user  50938162 2010-12-11 17:10 read1@4000001.bfq
-rw-r--r--  1 user user  51025084 2010-12-11 17:10 read1@6000001.bfq
-rw-r--r--  1 user user  51803458 2010-12-11 17:11 read1@8000001.bfq
-rw-r--r--  1 user user      2744 2010-12-11 17:09 ref.bfa
-rw-r--r--  1 user user   3579605 2010-12-11 17:13 unmap1@10000001.txt
-rw-r--r--  1 user user   3592541 2010-12-11 17:15 unmap1@12000001.txt
-rw-r--r--  1 user user   3790240 2010-12-11 17:14 unmap1@14000001.txt
-rw-r--r--  1 user user    492518 2010-12-11 17:13 unmap1@16000001.txt
-rw-r--r--  1 user user   3768747 2010-12-11 17:14 unmap1@1.txt
-rw-r--r--  1 user user   3668574 2010-12-11 17:12 unmap1@2000001.txt
-rw-r--r--  1 user user   3608445 2010-12-11 17:13 unmap1@4000001.txt
-rw-r--r--  1 user user   3429470 2010-12-11 17:13 unmap1@6000001.txt
-rw-r--r--  1 user user   3410453 2010-12-11 17:12 unmap1@8000001.txt
-rw-r--r--  1 user user         0 2010-12-11 17:18 unmap.indel

I’ve included the file sizes so you can see the amount of data generated from a 4 Kb phi_X174_sequence.fastq file and a 1.9 GB phi_X174_seq_fragments.fastq file.