/var/lib/ureadahead/debugfs And Disk Space “Recovery” In Ubuntu 10.04

And happy new year.

I had thought this was something involving Gaussian09 memory usage until I restarted a machine and found the same problem occurring in Ubuntu. Below is a quick fix (and reminder for the future).

Checking disk space with df -all :

user@machine:~$ df -all
Filesystem           1K-blocks      Used Available Use% Mounted on
/dev/sda1            147550696   5863896 134191632   5% /
proc                         0         0         0   -  /proc
none                         0         0         0   -  /sys
none                         0         0         0   -  /sys/fs/fuse/connections
none                         0         0         0   -  /sys/kernel/debug
none                         0         0         0   -  /sys/kernel/security
none                   3053752       260   3053492   1% /dev
none                         0         0         0   -  /dev/pts
none                   3058264         0   3058264   0% /dev/shm
none                   3058264        84   3058180   1% /var/run
none                   3058264         0   3058264   0% /var/lock
none                   3058264         0   3058264   0% /lib/init/rw
none                         0         0         0   -  /var/lib/ureadahead/debugfs
nfsd                         0         0         0   -  /proc/fs/nfsd
binfmt_misc                  0         0         0   -  /proc/sys/fs/binfmt_misc

… we find /var/lib/ureadahead/debugfs both existing but taking up no space to speak of. Several seconds later (after a reboot), we find the following…

user@machine:~$ df -all
Filesystem           1K-blocks      Used Available Use% Mounted on
/dev/sda1            147550696   5864268 134191260   5% /
proc                         0         0         0   -  /proc
none                         0         0         0   -  /sys
none                         0         0         0   -  /sys/fs/fuse/connections
none                         0         0         0   -  /sys/kernel/debug
none                         0         0         0   -  /sys/kernel/security
none                   3053752       260   3053492   1% /dev
none                         0         0         0   -  /dev/pts
none                   3058264         0   3058264   0% /dev/shm
none                   3058264        84   3058180   1% /var/run
none                   3058264         0   3058264   0% /var/lock
none                   3058264         0   3058264   0% /lib/init/rw
none                 147550696   5864268 134191260   5% /var/lib/ureadahead/debugfs
nfsd                         0         0         0   -  /proc/fs/nfsd
binfmt_misc                  0         0         0   -  /proc/sys/fs/binfmt_misc

Properly updated machines (as per below) both do not contain this /var/lib/ureadahead/debugfs directory and do not subsequently “blow up” and eat disk space (to date. This may not be the real problem, but disk space usage will increase to +60% and, to my mind, the machine will noticeably slow down).

Fix Steps:

sudo aptitude update
sudo aptitude upgrade

Update your 10.04. Some web pages report that the problem with /var/lib/ureadahead/debugfs is attributable to a bug in mountall (now fixed. See bugs.launchpad.net/ubuntu/+source/mountall/+bug/736512).

sudo mv /etc/init/ureadahead.conf /etc/init/ureadahead.conf.disable

If you do NOT perform this move, the machine restart will produce the same /var/lib/ureadahead/debugfs error above. Kudos to ubuntuguide.net/howto-fix-ureadahead-problem-after-upgrading-to-ubuntu-10-04 for pointing this out.

sudo shutdown -r now

System restart, problem (for me, at least) solved.

Maq-0.6.x Or Maq-0.7.x (And Likely Others) Installation In Ubuntu 10.04 LTS (And Likely Others)

So, with the BclConverter installation complete and a small QSEQ-to-FASTQ script available to convert the QSEQ output, the/a next step is the alignment of your lane-worth of sequenced DNA. The Maq program is used by the Cornell Sequencing Center (and was recommended as the workhorse tool for this task) and is available by link from the Illumina third-party tools list. In keeping with my no-interest-in-installing-another-distro run of Ubuntu luck, the procedure below explains the process of building Maq using as much apt-get as possible. In the case of Maq, there is one small busy step in the installation process because we need a copy of libstdc++.so.5 local that is NOT available by some easy package install (although what one has to do isn’t terribly difficult either and I’ve linked local copies of the two .deb files below).

Installation Procedure

The process begins with apt-get, continues to dpkg, and then is finished with an easy make.

1. apt-get Install List

The official package list, I am quite sure, is below. From a Terminal window:

sudo apt-get install zlib1g-dev libssl-dev build-essential gcc g++ rpm ia32-libs

I say this because I (1) have installed several other packages on the machines I’ve been working on prior to the Maq builds and (2) I’ve no interest in wiping machines to perfect a super-clean install. If there is an error in the Maq-make, it is possible an additional package is missing (although I suspect this will not be the case, as there is little needed for the Maq build). If there is an error, the solution may simply be to blindly add the following additional packages (and, if you installed the BclConverter, you have this all installed anyway).

YOU LIKELY DON’T NEED THE FOLLOWING, BUT JUST IN CASE:

sudo apt-get install build-essential mercurial cmake python2.6-dev python3.1-dev gettext
libopenal1 libopenexr-dev libavdevice52 freeglut3-dev libglew1.5-dev libxmu-dev libxi-dev
libfreeimage-dev doxygen libqt4-dev bison flex libbz2-dev libpng12-dev libxml-simple-perl
ia32-libs lib32asound2 lib32ncurses5 lib32nss-mdns lib32z1 lib32gfortran3 gcc-4.3-multilib
gcc-multilib lib32gomp1 libc6-dev-i386 lib32mudflap0 lib32gcc1 lib32gcc1-dbg lib32stdc++6
lib32stdc++6-4.3-dbg libc6-i386 csh g++ g++-4.3 libstdc++6-4.3-dev g++-multilib
g++-4.3-multilib gcc-4.3-doc libstdc++6-4.3-dbg libstdc++6-4.3-doc nfs-common
nfs-kernel-server portmap ssh gnuplot

2. Adding 32-bit (Needed For Both) And 64-bit (If Running 64-bit) libstdc++.so.5

The following process assumes you know where the two .deb files are sitting and that you have access to this folder (I assume you’ve downloaded to Downloads or Desktop, drive your Terminal window in that direction with cd ~/Downloads or cd ~/Desktop). The two .deb files in question that contain (I believe) the most recent versions of libstdc++.so.5 are linked below (and sitting on my website – you’ll have to unzip them with a double-click or a gunzip *.zip in the download’ed directory):


libstdc++5_3.3.6-18_i386.deb (as libstdc5_3.3.6_18_i386.deb.zip)
libstdc++5_3.3.6-18_amd64.deb (as libstdc5_3.3.6_18_amd64.deb.zip)

These are an “additional runtime library for C++ programs built with the GNU compiler.” The i386 is the 32-bit version. You definitely need this one. The amd64 is needed if you installed the 64-bit Ubuntu distro. You’ll STILL need to install the i386 version.

A. For the 32-bit version, the installation is simple:

sudo dpkg -i libstdc++5_3.3.6-18_i386.deb

B. For the 64-bit version, the installation is also simple:

sudo dpkg -i libstdc++5_3.3.6-18_amd64.deb

Output as below:

Selecting previously deselected package libstdc++5.
(Reading database ... 169294 files and directories currently installed.)
Unpacking libstdc++5 (from libstdc++5_3.3.6-18_amd64.deb) ...
Setting up libstdc++5 (1:3.3.6-18) ...

Processing triggers for libc-bin ...
ldconfig deferred processing now taking place

The second step is only mildly more involved. These five steps (1) extract out the contents of libstdc++5_3.3.6-18_i386.deb without installing the library (so no over-writing), (2) enter the usr/lib directory you just extracted, (3) copy libstdc++.so.5.0.7 to /usr/lib32, (4) cd into /usrlib32, and (5) make a symbolic link for libstdc++.so.5.

dpkg --extract libstdc++5_3.3.6-18_i386.deb ./
cd usr/lib
sudo cp libstdc++.so.5.0.7 /usr/lib32
cd /usr/lib32/
sudo ln -s libstdc++.so.5.0.7 libstdc++.so.5
cd ~/

And that is all.

3. Installing Maq

sudo mv maq-0.7.1.tar.bz2 /opt/
cd /opt
sudo tar xvjf maq-0.7.1.tar.bz2 

Produces…

tar: Record size = 8 blocks
maq-0.7.1/
maq-0.7.1/AUTHORS
maq-0.7.1/COPYING
maq-0.7.1/ChangeLog
maq-0.7.1/FUTURES
maq-0.7.1/INSTALL
maq-0.7.1/Makefile.am
maq-0.7.1/Makefile.generic
maq-0.7.1/Makefile.in
maq-0.7.1/NEWS
maq-0.7.1/PROBLEMS
maq-0.7.1/README
maq-0.7.1/aclocal.m4
maq-0.7.1/algo.hh
maq-0.7.1/altchr.cc
maq-0.7.1/assemble.cc
maq-0.7.1/assemble.h
maq-0.7.1/assopt.c
maq-0.7.1/autogen.sh
maq-0.7.1/aux_utils.c
maq-0.7.1/bfa.c
maq-0.7.1/bfa.h
maq-0.7.1/break_pair.c
maq-0.7.1/cleanup.sh
maq-0.7.1/config.guess
maq-0.7.1/config.h.in
maq-0.7.1/config.sub
maq-0.7.1/configure
maq-0.7.1/configure.ac
maq-0.7.1/const.c
maq-0.7.1/const.h
maq-0.7.1/csmap2ntmap.cc
maq-0.7.1/dword.hh
maq-0.7.1/eland2maq.cc
maq-0.7.1/fasta2bfa.c
maq-0.7.1/fastq2bfq.c
maq-0.7.1/genran.c
maq-0.7.1/genran.h
maq-0.7.1/get_pos.c
maq-0.7.1/glf.h
maq-0.7.1/glfgen.cc
maq-0.7.1/indel_call.cc
maq-0.7.1/indel_pe.cc
maq-0.7.1/indel_soa.cc
maq-0.7.1/install-sh
maq-0.7.1/main.c
maq-0.7.1/main.h
maq-0.7.1/mapcheck.cc
maq-0.7.1/maq.1
maq-0.7.1/maq.pdf
maq-0.7.1/maq.pod
maq-0.7.1/maqmap.c
maq-0.7.1/maqmap.h
maq-0.7.1/maqmap_conv.c
maq-0.7.1/match.cc
maq-0.7.1/match.hh
maq-0.7.1/match_aux.cc
maq-0.7.1/merge.cc
maq-0.7.1/missing
maq-0.7.1/pair_stat.cc
maq-0.7.1/pileup.cc
maq-0.7.1/rbcc.cc
maq-0.7.1/read.cc
maq-0.7.1/read.h
maq-0.7.1/rmdup.cc
maq-0.7.1/scripts/
maq-0.7.1/scripts/asub
maq-0.7.1/scripts/farm-run.pl
maq-0.7.1/scripts/fq_all2std.pl
maq-0.7.1/scripts/maq.pl
maq-0.7.1/scripts/maq_eval.pl
maq-0.7.1/scripts/maq_plot.pl
maq-0.7.1/scripts/maq_post.pl
maq-0.7.1/scripts/maq_sanger.pl
maq-0.7.1/scripts/paf_utils.pl
maq-0.7.1/scripts/solid2fastq.pl
maq-0.7.1/seq.c
maq-0.7.1/seq.h
maq-0.7.1/simulate.c
maq-0.7.1/sort_mapping.cc
maq-0.7.1/stdaln.c
maq-0.7.1/stdaln.h
maq-0.7.1/stdhash.hh
maq-0.7.1/submap.c
maq-0.7.1/subsnp.cc
cd maq-0.7.1/

README Contents

Mapass2 is a software that builds mapping assemblies from short reads
generated by the next-generation sequencing machines. It is particularly
designed for Illumina-Solexa 1G Genetic Analyzer, which typically
generates reads 25-35bp in length.

Mapass2 first aligns reads to reference sequences and then calls the
consensus. At the mapping stage, maq performs ungapped alignment. For
single-end reads, maq is able to find all hits with up to 2 or 3
mismatches, depending on a command-line option; for paired-end reads, it
always finds all paired hits with one of the two reads containing up to
1 mismatch. At the assembling stage, maq calls the consensus based on a
statistical model. It calls the base which maximizes the posterior
probability and calculates a phred quality at each position along the
consensus. Heterozygotes are also called in this process.

For more information, see also maq website:

http://mapass.sourceforge.net

INSTALL Contents

There are two ways to compile maq. The first way is to use the GNU
building systems. Simply type ‘./configure; make; make install’ to
compile and to install maq. Three executables ‘maq’, ‘maq.pl’ and
‘farm-run.pl’ will be copied to ‘/usr/local/bin’ by default.

Alternatively, one could compile with ‘make -f Makefile.generic’ and
manually copy the three executables to the destination directory.
Modification to ‘Makefile.generic’ is sometimes needed for different
architectures.

As I’m running this from /opt, we’ll be doing the first way to compile Maq but using “sudo” in each case.

USERID@MACHINE:/opt/maq-0.7.1$ sudo ./configure 

Produces…

checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for a thread-safe mkdir -p... /bin/mkdir -p
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking build system type... x86_64-unknown-linux-gnu
checking host system type... x86_64-unknown-linux-gnu
checking for gcc... gcc
checking for C compiler default output file name... a.out
checking whether the C compiler works... yes
checking whether we are cross compiling... no
checking for suffix of executables... 
checking for suffix of object files... o
checking whether we are using the GNU C compiler... yes
checking whether gcc accepts -g... yes
checking for gcc option to accept ISO C89... none needed
checking for g++... g++
checking whether we are using the GNU C++ compiler... yes
checking whether g++ accepts -g... yes
checking if gcc accepts -m64... yes
checking how to run the C preprocessor... gcc -E
checking for grep that handles long lines and -e... /bin/grep
checking for egrep... /bin/grep -E
checking for ANSI C header files... yes
checking for sys/types.h... yes
checking for sys/stat.h... yes
checking for stdlib.h... yes
checking for string.h... yes
checking for memory.h... yes
checking for strings.h... yes
checking for inttypes.h... yes
checking for stdint.h... yes
checking for unistd.h... yes
checking zlib.h usability... yes
checking zlib.h presence... yes
checking for zlib.h... yes
configure: creating ./config.status
config.status: creating Makefile
config.status: creating config.h
USERID@MACHINE:/opt/maq-0.7.1$ sudo make

Produces…

cd . && /bin/bash /opt/maq-0.7.1/missing --run autoheader
/opt/maq-0.7.1/missing: line 54: autoheader: command not found
WARNING: `autoheader' is missing on your system.  You should only need it if
         you modified `acconfig.h' or `configure.ac'.  You might want
         to install the `Autoconf' and `GNU m4' packages.  Grab them
         from any GNU archive site.
rm -f stamp-h1
touch config.h.in
cd . && /bin/bash ./config.status config.h
config.status: creating config.h
config.status: config.h is unchanged
make  all-am
make[1]: Entering directory `/opt/maq-0.7.1'
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c main.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c const.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c seq.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c bfa.c
bfa.c: In function ‘nst_load_bfa1’:
bfa.c:31: warning: ignoring return value of ‘fread’, declared with attribute warn_unused_result
bfa.c:32: warning: ignoring return value of ‘fread’, declared with attribute warn_unused_result
bfa.c:33: warning: ignoring return value of ‘fread’, declared with attribute warn_unused_result
bfa.c:35: warning: ignoring return value of ‘fread’, declared with attribute warn_unused_result
bfa.c:37: warning: ignoring return value of ‘fread’, declared with attribute warn_unused_result
bfa.c: In function ‘nst_bfa_len’:
bfa.c:46: warning: ignoring return value of ‘fread’, declared with attribute warn_unused_result
bfa.c:48: warning: ignoring return value of ‘fread’, declared with attribute warn_unused_result
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o read.o read.cc
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c fasta2bfa.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c fastq2bfq.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o merge.o merge.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o match_aux.o
 match_aux.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o match.o match.cc
match.cc: In function ‘int alt_cal_mm(bit64_t)’:
match.cc:58: warning: suggest parentheses around ‘+’ in operand of ‘&’
match.cc:61: warning: suggest parentheses around ‘+’ in operand of ‘&’
match.cc: In function ‘int alt_cal_err(bit64_t, bit64_t)’:
match.cc:67: warning: suggest parentheses around ‘+’ in operand of ‘&’
match.cc:70: warning: suggest parentheses around ‘+’ in operand of ‘&’
match.cc: In function ‘int ma_match(int, char**)’:
match.cc:525: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)’, declared 
with attribute 
warn_unused_result
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o sort_mapping.o 
sort_mapping.cc
sort_mapping.cc: In function ‘int ma_make_pair(const match_aux_t*, const match_info_t*, const 
match_info_t*, 
pair_info_t*)’:
sort_mapping.cc:59: warning: suggest parentheses around arithmetic in operand of ‘^’
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o assemble.o 
assemble.cc
assemble.cc: In function ‘base_call_aux_t* assemble_cns_collect(assemble_pos_t*, const 
assemble_aux_t*)’:
assemble.cc:106: warning: suggest parentheses around arithmetic in operand of ‘|’
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o 
pileup.o pileup.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o 
mapcheck.o mapcheck.cc
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c get_pos.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c assopt.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c aux_utils.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o rbcc.o rbcc.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o subsnp.o 
subsnp.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o pair_stat.o 
pair_stat.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o indel_soa.o 
indel_soa.cc
indel_soa.cc: In function ‘void fill_counter(bit32_t*, int, nst_bfa1_t*, void*)’:
indel_soa.cc:42: warning: suggest parentheses around ‘-’ inside ‘< <’
indel_soa.cc:56: warning: suggest parentheses around ‘-’ inside ‘<<’
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c maqmap.c
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c maqmap_conv.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o altchr.o 
altchr.cc
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c submap.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o rmdup.o 
rmdup.cc
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c simulate.c
In file included from /usr/include/string.h:640,
                 from maqmap.h:23,
                 from simulate.c:11:
In function ‘memset’,
    inlined from ‘simustat_core’ at simulate.c:386:
/usr/include/bits/string3.h:86: warning: call to __builtin___memset_chk will always overflow 
destination buffer
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c genran.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o indel_pe.o 
indel_pe.cc
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c stdaln.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o indel_call.o 
indel_call.cc
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o 
eland2maq.o eland2maq.cc
eland2maq.cc: In function ‘hash_map_char* read_list(FILE*)’:
eland2maq.cc:33: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)’, 
declared with attribute warn_unused_result
eland2maq.cc: In function ‘void eland2maq_core(FILE*, FILE*, void*)’:
eland2maq.cc:88: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)’, 
declared with attribute warn_unused_result
eland2maq.cc:96: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)’, 
declared with attribute warn_unused_result
eland2maq.cc:99: warning: ignoring return value of ‘int fscanf(FILE*, const char*, ...)’, 
declared with attribute warn_unused_result
eland2maq.cc: In function ‘void novo2maq_core(FILE*, FILE*, void*)’:
eland2maq.cc:323: warning: ignoring return value of ‘char* fgets(char*, int, FILE*)’, declared 
with attribute warn_unused_result
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o 
csmap2ntmap.o csmap2ntmap.cc
gcc -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c break_pair.c
g++ -DHAVE_CONFIG_H -I.     -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2 -c -o 
glfgen.o glfgen.cc
glfgen.cc: In function ‘glf1_t* glfgen1_core(assemble_pos_t*, const assemble_aux_t*, bit8_t)’:
glfgen.cc:43: warning: suggest parentheses around arithmetic in operand of ‘|’
g++  -Wall -m64 -D_FASTMAP -DMAQ_LONGREADS -g -O2   -o maq main.o const.o seq.o bfa.o read.o 
fasta2bfa.o fastq2bfq.o merge.o match_aux.o match.o sort_mapping.o assemble.o pileup.o 
mapcheck.o 
get_pos.o assopt.o aux_utils.o rbcc.o subsnp.o pair_stat.o indel_soa.o maqmap.o maqmap_conv.o 
altchr.o submap.o rmdup.o simulate.o genran.o indel_pe.o stdaln.o indel_call.o eland2maq.o 
csmap2ntmap.o break_pair.o glfgen.o -lm -lz 
make[1]: Leaving directory `/opt/maq-0.7.1'
USERID@MACHINE:/opt/maq-0.7.1$ sudo make install

Produces…

make[1]: Entering directory `/opt/maq-0.7.1'
test -z "/usr/local/bin" || /bin/mkdir -p "/usr/local/bin"
  /usr/bin/install -c 'maq' '/usr/local/bin/maq'
test -z "/usr/local/bin" || /bin/mkdir -p "/usr/local/bin"
 /usr/bin/install -c 'scripts/maq.pl' '/usr/local/bin/maq.pl'
 /usr/bin/install -c 'scripts/farm-run.pl' '/usr/local/bin/farm-run.pl'
 /usr/bin/install -c 'scripts/maq_plot.pl' '/usr/local/bin/maq_plot.pl'
 /usr/bin/install -c 'scripts/maq_eval.pl' '/usr/local/bin/maq_eval.pl'
make[1]: Nothing to be done for `install-data-am'.
make[1]: Leaving directory `/opt/maq-0.7.1'

The Maq package is installed in /usr/local/bin and should be available immediately without any path calls. In the interest of running a brief test, I’ve provided a fastq file for phi-X174 and the “easy” command line run to run an alignment (rendered movie from the virusworld website, including a second half featuring the lovely QuteMol program, is below). While I wouldn’t object to hosting a full lane of phi-X174, the 1.9 GB of fragments = unbearably long server upload. Suffice it to say, if you have a phi-X174 lane and you’ve run the BCL-to-QSEQ-to-FASTQ procedure in the BclConverter post, you have a properly formatted PhiXSequence.fastq for running this example.

You can download the phi-X174 sequence at phi_X174_sequence.fastq.gz, a local version of the file you can find at the National Center for Biotechnology Information. The sequence is below because, well, I wanted to have a sequence present on the blog post (and it is absolutely fascinating to me that this is the instruction manual for something).

>gi|216019|gb|J02482.1|PX1CG Coliphage phi-X174, complete genome
GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCGGAAGGAG
TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCATGATGTTATTTCTTCATTTGGAGGTAAAAC
CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
CGGGCAATAACGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTGCTATTCAGCGTTTGATGAATGCAATGCGACAG
GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
CGTCTTCATTTCCATGCGGTGCACTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA

With this file downloaded and your phi-X174 fragment collection sitting in a file [I will assume is named] phi_X174_seq_fragments.fastq in the same directory, the command line run is simple:

maq.pl easyrun -d phi_X174 phi_X174_seq.fastq phi_X174_seq_fragments.fastq >& phi_X174.log
drwxr-xr-x 2 user user       4096 2010-12-11 17:18 phi_X174
-rw-r--r-- 1 user user       3524 2010-12-11 17:18 phi_X174.log
-rw-r--r-- 1 user user       5529 2010-12-11 16:39 phi_X174_seq.fastq
-rw-r--r-- 1 user user 1921502305 2010-12-11 16:40 phi_X174_seq_fragments.fastq

This will produce the phi_X174.log results file (check for errors. Log contents below)…

-- CMD: /usr/local/bin/maq fasta2bfa /home/user/phi_X174_seq.fastq \ 
phi_X174/ref.bfa 2> /dev/null
-- CMD: /usr/local/bin/maq fastq2bfq -n 2000000 /home/user/phi_X174_seq_fragments.fastq \
phi_X174/read1
-- finish writing file 'phi_X174/read1@1.bfq'
-- finish writing file 'phi_X174/read1@2000001.bfq'
-- finish writing file 'phi_X174/read1@4000001.bfq'
-- finish writing file 'phi_X174/read1@6000001.bfq'
-- finish writing file 'phi_X174/read1@8000001.bfq'
-- finish writing file 'phi_X174/read1@10000001.bfq'
-- finish writing file 'phi_X174/read1@12000001.bfq'
-- finish writing file 'phi_X174/read1@14000001.bfq'
-- finish writing file 'phi_X174/read1@16000001.bfq'
-- 16259703 sequences were loaded.
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@8000001.txt \
aln1@8000001.map ref.bfa read1@8000001.bfq 2> aln1@8000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@2000001.txt \
aln1@2000001.map ref.bfa read1@2000001.bfq 2> aln1@2000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@6000001.txt \
aln1@6000001.map ref.bfa read1@6000001.bfq 2> aln1@6000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@10000001.txt \
aln1@10000001.map ref.bfa read1@10000001.bfq 2> aln1@10000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@16000001.txt \
aln1@16000001.map ref.bfa read1@16000001.bfq 2> aln1@16000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@4000001.txt \
aln1@4000001.map ref.bfa read1@4000001.bfq 2> aln1@4000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@14000001.txt \
aln1@14000001.map ref.bfa read1@14000001.bfq 2> aln1@14000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@1.txt aln1@1.map \
ref.bfa read1@1.bfq 2> aln1@1.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq map  -n 2 -e 70 -u unmap1@12000001.txt \
aln1@12000001.map ref.bfa read1@12000001.bfq 2> aln1@12000001.map.log)
-- CMD: (cd phi_X174; /usr/local/bin/maq mapmerge all.map aln1@8000001.map \
aln1@2000001.map aln1@6000001.map aln1@10000001.map aln1@16000001.map \
aln1@4000001.map aln1@14000001.m
ap aln1@1.map aln1@12000001.map)
-- CMD: (cd phi_X174; /usr/local/bin/maq mapcheck ref.bfa all.map > mapcheck.txt)
[ma_mapcheck] processing gi|216019|gb|J02482.1|PX1CG...
-- CMD: (cd phi_X174; /usr/local/bin/maq assemble -N 2 -Q 60 consensus.cns ref.bfa \
all.map 2> assemble.log)
-- CMD: /usr/local/bin/maq cns2fq phi_X174/consensus.cns > phi_X174/cns.fq
-- CMD: /usr/local/bin/maq cns2snp phi_X174/consensus.cns > phi_X174/cns.snp
-- CMD: /usr/local/bin/maq cns2win phi_X174/consensus.cns > phi_X174/cns.win
-- CMD: /usr/local/bin/maq indelsoa phi_X174/ref.bfa phi_X174/all.map > phi_X174/cns.indelse
-- CMD: (cd phi_X174; touch unmap.indel)
-- CMD: /usr/local/bin/maq.pl SNPfilter -q 40 -w 5 -N 2 -f phi_X174/cns.indelse -d 3 \
-D 256 -n 20 phi_X174/cns.snp > phi_X174/cns.final.snp
-- 0 potential soa-indels pass the filter.
-- CMD: (cd phi_X174; ln -s cns.final.snp cns.filter.snp)
-- CMD: /usr/local/bin/maq.pl statmap phi_X174/*.map.log

-- == statmap report ==

-- # single end (SE) reads: 16259703
-- # mapped SE reads: 16011454 (/ 16259703 = 98.47%)
-- # paired end (PE) reads: 0
-- # mapped PE reads: 0 (/ 0 = NA%)
-- # reads that are mapped in pairs: 0 (/ 0 = NA%)
-- # Q>=30 reads that are moved to meet mate-pair requirement: 0 (/ 0 = NA%)
-- # Q<30 reads that are moved to meet mate-pair requirement: 0 (NA%)

…and a “phi_X174” directory (from the “-d”) containing (hopefully) the following file list:

drwxr-xr-x  2 user user      4096 2010-12-11 17:18 .
drwxr-xr-x 19 user user      4096 2010-12-11 17:09 ..
-rw-r--r--  1 user user 337296876 2010-12-11 17:16 all.map
-rw-r--r--  1 user user  41635667 2010-12-11 17:13 aln1@10000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:13 aln1@10000001.map.log
-rw-r--r--  1 user user  42219864 2010-12-11 17:15 aln1@12000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:15 aln1@12000001.map.log
-rw-r--r--  1 user user  42885466 2010-12-11 17:14 aln1@14000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:14 aln1@14000001.map.log
-rw-r--r--  1 user user   5808963 2010-12-11 17:13 aln1@16000001.map
-rw-r--r--  1 user user     18484 2010-12-11 17:13 aln1@16000001.map.log
-rw-r--r--  1 user user  42616782 2010-12-11 17:14 aln1@1.map
-rw-r--r--  1 user user     18493 2010-12-11 17:14 aln1@1.map.log
-rw-r--r--  1 user user  41452684 2010-12-11 17:12 aln1@2000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:12 aln1@2000001.map.log
-rw-r--r--  1 user user  41223383 2010-12-11 17:14 aln1@4000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:14 aln1@4000001.map.log
-rw-r--r--  1 user user  41423788 2010-12-11 17:13 aln1@6000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:13 aln1@6000001.map.log
-rw-r--r--  1 user user  42709777 2010-12-11 17:12 aln1@8000001.map
-rw-r--r--  1 user user     18493 2010-12-11 17:12 aln1@8000001.map.log
-rw-r--r--  1 user user      8704 2010-12-11 17:18 assemble.log
lrwxrwxrwx  1 user user        13 2010-12-11 17:18 cns.filter.snp -> cns.final.snp
-rw-r--r--  1 user user       509 2010-12-11 17:18 cns.final.snp
-rw-r--r--  1 user user     10983 2010-12-11 17:18 cns.fq
-rw-r--r--  1 user user         0 2010-12-11 17:18 cns.indelse
-rw-r--r--  1 user user       571 2010-12-11 17:18 cns.snp
-rw-r--r--  1 user user       452 2010-12-11 17:18 cns.win
-rw-r--r--  1 user user      3555 2010-12-11 17:18 consensus.cns
-rw-r--r--  1 user user      4525 2010-12-11 17:17 mapcheck.txt
-rw-r--r--  1 user user  51219471 2010-12-11 17:11 read1@10000001.bfq
-rw-r--r--  1 user user  51533445 2010-12-11 17:11 read1@12000001.bfq
-rw-r--r--  1 user user  52014489 2010-12-11 17:12 read1@14000001.bfq
-rw-r--r--  1 user user   6777154 2010-12-11 17:12 read1@16000001.bfq
-rw-r--r--  1 user user  51764856 2010-12-11 17:09 read1@1.bfq
-rw-r--r--  1 user user  51064770 2010-12-11 17:10 read1@2000001.bfq
-rw-r--r--  1 user user  50938162 2010-12-11 17:10 read1@4000001.bfq
-rw-r--r--  1 user user  51025084 2010-12-11 17:10 read1@6000001.bfq
-rw-r--r--  1 user user  51803458 2010-12-11 17:11 read1@8000001.bfq
-rw-r--r--  1 user user      2744 2010-12-11 17:09 ref.bfa
-rw-r--r--  1 user user   3579605 2010-12-11 17:13 unmap1@10000001.txt
-rw-r--r--  1 user user   3592541 2010-12-11 17:15 unmap1@12000001.txt
-rw-r--r--  1 user user   3790240 2010-12-11 17:14 unmap1@14000001.txt
-rw-r--r--  1 user user    492518 2010-12-11 17:13 unmap1@16000001.txt
-rw-r--r--  1 user user   3768747 2010-12-11 17:14 unmap1@1.txt
-rw-r--r--  1 user user   3668574 2010-12-11 17:12 unmap1@2000001.txt
-rw-r--r--  1 user user   3608445 2010-12-11 17:13 unmap1@4000001.txt
-rw-r--r--  1 user user   3429470 2010-12-11 17:13 unmap1@6000001.txt
-rw-r--r--  1 user user   3410453 2010-12-11 17:12 unmap1@8000001.txt
-rw-r--r--  1 user user         0 2010-12-11 17:18 unmap.indel

I’ve included the file sizes so you can see the amount of data generated from a 4 Kb phi_X174_sequence.fastq file and a 1.9 GB phi_X174_seq_fragments.fastq file.

Vitamin B12 In Drug Delivery: Breaking Through The Barriers To A B12 Bioconjugate Pharmaceutical

In press in Expert Opinion On Drug Delivery (DOI:10.1517/17425247.2011.539200). The theory section (the only part I can properly speak to) builds on the discussion section of the full theory paper in Molecular Biosystems from earlier this year, providing an outlet for some of the more speculative design possibilities for trinary B12 bioconjugate design. Given that (1) there are mechanisms for cleavage at both of the proposed positions and (2) the molecular dynamics work indicates that, at least, TCII (transcobalamin II) can easily accommodate a bi-functionalized cobalamin, the A-B12-C design possibility is probably the most interesting long-term idea to come out of the computational side of the B12-insulin bioconjugate study (or so I argue).

Having “B12” and “cobalamin” in a blog post guarantees a bunch of useless moderation-necessary comments from vita-spam sites.

Susan M. Clardy, Damian G. Allis, Timothy J. Fairchild & Robert P. Doyle

Syracuse University, Syracuse, Department of Chemistry, NY 13244-4100, USA

Importance of the field: Vitamin B12 (B12) is a rare and vital micronutrient for which mammals have developed a complex and highly efficient dietary uptake system. This uptake pathway consists of a series of proteins and receptors, and has been utilized to deliver several bioactive and/or imaging molecules from 99mTc to insulin.

Areas covered in this review: The current field of B12-based drug delivery is reviewed, including recent highlights surrounding the very pathway itself.

What the reader will gain: Despite over 30 years of work, no B12-based drug delivery conjugate has reached the market-place, hampered by issues such as limited uptake capacity, gastrointestinal degradation of the conjugate or high background uptake by healthy tissues. Variability in dose response among individuals, especially across ageing populations and slow oral uptake (several hours), has also slowed development and interest.

Take home message: This review is intended to stress again the great potential, as yet not fully realized, for B12-based therapeutics, tumor imaging and oral drug delivery. This review discusses recent reports that demonstrate that the issues noted above can be overcome and need not be seen as negating the great potential of B12 in the drug delivery field.